International Journal of Biological Sciences

Impact factor
3.873

ISSN 1449-2288

News feeds of IJBS published articles
My Manuscript
My Account

Journal of Biomedicinenew

Theranostics

International Journal of Medical Sciences

Journal of Cancer

Oncomedicine

Journal of Genomics

Journal of Bone and Joint Infection (JBJI)

Nanotheranostics

Journal of Genomics now in PubMed/PubMed Central. Submit manuscript...

PubMed Central Indexed in Journal Impact Factor

Int J Biol Sci 2012; 8(1):124. doi:10.7150/ijbs.8.124

Erratum

Correction: Molecular Characterization of Transcriptome-wide Interactions between Highly Pathogenic Porcine Reproductive and Respiratory Syndrome Virus and Porcine Alveolar Macrophages in vivo

Ping Zhou, Shanli Zhai, Xiang Zhou, Ping Lin, Tengfei Jiang, Xueying Hu, Yunbo Jiang, Bin Wu, Qingde Zhang, Xuewen Xu, Jin-ping Li, Bang Liu Corresponding address

This is an open access article distributed under the terms of the Creative Commons Attribution (CC BY-NC) License. See http://ivyspring.com/terms for full terms and conditions.
How to cite this article:
Zhou P, Zhai S, Zhou X, Lin P, Jiang T, Hu X, Jiang Y, Wu B, Zhang Q, Xu X, Li Jp, Liu B. Correction: Molecular Characterization of Transcriptome-wide Interactions between Highly Pathogenic Porcine Reproductive and Respiratory Syndrome Virus and Porcine Alveolar Macrophages in vivo. Int J Biol Sci 2012; 8(1):124. doi:10.7150/ijbs.8.124. Available from http://www.ijbs.com/v08p0124.htm

Corrected-article in Int J Biol Sci, Volume 7, 947

 

During the revision process several genes for Q-PCR validation were changed in the Figure 4 according to the suggestion from the reviewers, however, the Q-PCR primers information in the Table 1 has been ignored to be corrected accordingly. Here, the corrected version of the Table 1 is shown below. We apologize for this oversight and for any confusion that it has caused.

 Table 1 

Primers used for Q-PCR validation.

GenePrimer sequence (5'-3')Target size (bp)Tm (℃)a
ATP6V1B2Forward: CAAGCCATGAAAGCCGTAGTT
Reverse: TGCCAGCCAATGTCCAAAGT
14960
C3Forward: AAACTAAAGGAGGGGGGACACT
Reverse: CTTGGCATACATCACCATCAGG
13360
CCL2Forward: AACTTGCCCTAAATACCCTCAGA
Reverse: GGAAAGCAATGTGCCCAAGTC
17961
DDIT3Forward: ACGGCTCAAGCAGGAAATC
Reverse: CACTGGTAAGAAGGTGGTTGGT
17358
GLRX2Forward: TACGGAAGCCAGTTTCAAGAC
Reverse: CTTGGTGAAGCCTATGAGTGTC
11858
SLC39A14Forward: TCTCTGCCTGCTGCTGTTACG
Reverse: GCCTTCCTTTCATCCTCTTGG
16660
TNFForward: CATCGCCGTCTCCTACCA
Reverse: CCCAGATTCAGCAAAGTCCA
19958
RPL32bForward: CGGAAGTTTCTGGTACACAATGTAA
Reverse: TGGAAGAGACGTTGTGAGCAA
9458-61

aThe annealing temperature represents the optimal temperature during quantitative PCR;

bRNA levels of RPL32 was assayed for normalization during quantitative PCR.

Author contact

Corresponding address Corresponding author: liubanghzau.edu.cn; Tel: +86 27 87284140; Fax: +86 27 87280408


Published 2011-12-1